View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_45 (Length: 267)
Name: NF11780_high_45
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 38066508 - 38066273
Alignment:
| Q |
14 |
agacaaaaaccaaatgcccgacgtggtggccaacaccgctatcattgaagcttatgccaatgctggtcaaccaaaagaagctcttaaagcttacatgcgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38066508 |
agacaaaaaccaaatgcccgacgtggtggccaacaccgctatcattgaagcttatgccaatgctggtcaaccaaaagaagctcttaaagcttacatgcgt |
38066409 |
T |
|
| Q |
114 |
atgcttgcttctggggtttgtcctaatgcttatacctacactgttcttgttaagggacttgcatctgatgctaagtttttgaaggatgcgaagaagtatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38066408 |
atgcttgcttctggggtttgtcctaatgcttatacctacactgttattattaagggacttgcttctgatgctaagtttttgaaggatgcgaagaagtatt |
38066309 |
T |
|
| Q |
214 |
tgttggagatgatggagaaagggatgagacctaatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38066308 |
tgttggagatgatggagaaagggatgagacctaatg |
38066273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University