View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_53 (Length: 242)
Name: NF11780_high_53
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 53 - 223
Target Start/End: Complemental strand, 11406194 - 11406022
Alignment:
| Q |
53 |
gcacagtgccagacattcacattttggagacaa--atcacgcaccattagatcataagagaaaagctgcgctagcagagaaagaagcagggtgctggatc |
150 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
11406194 |
gcacagtgccaggcattcacattttggagacaaggatcacgcaccattagatcataagacaaaagctgcgctagcagagaaagaagcagggtgttggttc |
11406095 |
T |
 |
| Q |
151 |
aatggaaaataacggcagacgagaaagatacatttccaggtttaattcttttactatgttgtttatttatgtc |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11406094 |
aatggaaaataatggcagacgagaaagatacattttcgggtttaattcttttactatgttgtttatttatgtc |
11406022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University