View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_58 (Length: 240)
Name: NF11780_high_58
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 48820020 - 48819836
Alignment:
| Q |
1 |
atttattataaattatttcttagaaatgggtcacttttgagaccaaaaaccaccagtttagagaccaaaatcatcataagtcttcagcacttttaatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
48820020 |
atttattataaattatttcttagaaatgggtcacttttaagaccaaaaaccgccagtttagagccaaaaatcatcataagtcttcagcacttttaatcct |
48819921 |
T |
 |
| Q |
101 |
ttaaccaaaatccgttgagctaccaaactctaagataaattgtgtttctcttatatcctctacggtatgtatatttctatgcata |
185 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48819920 |
ttaaccaaaatcagttgagctaccaaactctaagataaattgtgtttctcttatatcctctacgggatgtatatttctatgcata |
48819836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University