View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_60 (Length: 220)
Name: NF11780_high_60
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 201
Target Start/End: Original strand, 40739440 - 40739639
Alignment:
| Q |
2 |
cagtgaaatcacagtgaccatgttcatagctgcactgcctcttcccttagacatatttgatattttctatcttagtataaaaactatatgtttctatagc |
101 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40739440 |
cagtgaaatcacaatgaccatgttcatagctgcactgcctcttcccttagacatatttgatattttctatcttagtataaaaactatatgtttctagagc |
40739539 |
T |
 |
| Q |
102 |
aaatttataagtgaaatggtcgagttggcttgtaagtattagacctatcggtttttataatagaatttggttgatcaatctgttgagctatggggccata |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40739540 |
aaatttataagtgaaatggtcgagttggcttgtaagtatgagacctatcggtttttataatagaatttggttgatcaatctgttgagctatggggccata |
40739639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 40746387 - 40746443
Alignment:
| Q |
2 |
cagtgaaatcacagtgaccatgttcatagctgcactgcctcttcccttagacatatt |
58 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
40746387 |
cagtgaaattagagtgaccatgttcatagaagcactgcctcttccctcagtcatatt |
40746443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University