View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_low_40 (Length: 355)
Name: NF11780_low_40
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 194 - 345
Target Start/End: Complemental strand, 47127150 - 47126999
Alignment:
| Q |
194 |
gcaacttactaagtatcaattttaaaaatatgtacatacatttgtaaatatatatgagatgagaattacattggaaaatataaaattaacacatgtatat |
293 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127150 |
gcaactcactaagtatcaattttaaaaatatgtacatacatgtgtaaatatatatgagatgagaattacattggaaaatataaaattaacacatgtatat |
47127051 |
T |
 |
| Q |
294 |
tatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatg |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127050 |
tatagaactttgcacctgaaaacccagcttttaataaatttggtcgcctatg |
47126999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 36 - 148
Target Start/End: Complemental strand, 47127312 - 47127200
Alignment:
| Q |
36 |
aacattgtacttatacactttaccacatgatgataattgaaaatgtaaacggtaacatggaaaacttacgaaatgcatcacattgcccttcaaccggaag |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47127312 |
aacattgtacttatacactttaccacatgatgataattgaaaatgtaaacggtaacatggaaaacttacgaaacgcatcacattgcccttcaaccggaag |
47127213 |
T |
 |
| Q |
136 |
cttcaagtcatct |
148 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47127212 |
cttcaagtcatct |
47127200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University