View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_low_52 (Length: 267)
Name: NF11780_low_52
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 257
Target Start/End: Original strand, 1330317 - 1330566
Alignment:
| Q |
8 |
cgagtgagatgaaaccatgaactgcaagaaaaagtggagaaactaaaagttaataaaaggaaccagtgtttgagagcaccacaagccaacacacagatta |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1330317 |
cgagtgatttgaaaccatgaactgcaagaaaaagtggagaaactaaaagttaataaaaggaaccagtgtttgagagcaccgcaagccaacacacagatta |
1330416 |
T |
 |
| Q |
108 |
attagtgcaaaattacccttgtcatcatcttcgtcttctatcctacttgtactaccagggtcttcatcaacagcaatggcaacataatcgctattgccct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1330417 |
attagtgcaaaattacccttgtcatcatcttcgtcttctatcctacttgtactaccagggtcttcatcaacagcaatggcaacataatcgctattgccct |
1330516 |
T |
 |
| Q |
208 |
tgcgcaaacttcgaacttgaggtgtaacaaaagtcccagttgatgtccat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
1330517 |
tgcgcaaacttcgaacttgaggtgtaacaaaagtccccgttgttgtccat |
1330566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University