View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_low_58 (Length: 248)
Name: NF11780_low_58
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 2795180 - 2794973
Alignment:
| Q |
13 |
agataagttgcacctgttttctgctggttgcgttttacaagatcatcaaatcacgttgggaccaaagtaaatgac-ttttctgtcttgagcgtctcttcg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2795180 |
agataagttgcacctgttttctgctggttgcattttacaagatcatcaaatcacgttgggaccaaagtaaatgactttttctgtcttgagtgtctcttcg |
2795081 |
T |
 |
| Q |
112 |
tcatacatacccaaccagaatcacaaaatgttgtaagcttaggattttatgcattgattagataaattccatgtgaaatgtttgatttgagacattatag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2795080 |
tcatacatacccaaccagaatcacaaaatgttgtaagc---------tatgcattgattagataaattccatgtgaaatggttgatttgagacattatag |
2794990 |
T |
 |
| Q |
212 |
aataggcttcaatgcat |
228 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2794989 |
aataggcttcaatgcat |
2794973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University