View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_low_63 (Length: 240)
Name: NF11780_low_63
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 50074096 - 50073884
Alignment:
| Q |
11 |
ttccacacgggagtggcgactttttaatttatactagcctaaaataagaccttgaggaattgctatacgataatgcaagcatttccccacattaattatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50074096 |
ttccacacgggagtggcgactttttaatttatactagcctaaaataagaccttgaggaattgctatacgataatgcaagcatttccccacattaattatt |
50073997 |
T |
|
| Q |
111 |
acagattggcaaacatgaaattgaaaattaaaacttacttataaactttcgtgttctaggggtaactccacagtgacctattgctgcattgcagcgccta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50073996 |
acagattggcaaacatgaaattgaaaattaaaacttacttataaactttcgtgttctaggggcaactccacagtgacctattgctccattgcagcgccta |
50073897 |
T |
|
| Q |
211 |
taaattaacgcat |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
50073896 |
taaattaacgcat |
50073884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University