View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_low_64 (Length: 240)
Name: NF11780_low_64
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_low_64 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 14008950 - 14008728
Alignment:
| Q |
18 |
tcattaagtttactattagcaaacatagttcaagaaaacatagataaatattctgtagagaaatgcacaaaataattcatagatggtgaaatcaaaatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14008950 |
tcattaagtttactattagcaaacatagttcaagaaaacatagataaatattctatagagaaatgcacaaaataattcatagatggtgaaatcaaaatct |
14008851 |
T |
|
| Q |
118 |
gatttaaaagtgagactaccttgatttccctaattgctctatggctttttcaacttcagtcccatgttcttggaagcatgagacctatcctaatattcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14008850 |
gatttaaaagtgagactaccttgattttcctaattgctctatggctttttcaacttcagtcccatgttcttggaagcatgagacctatcctaatattcat |
14008751 |
T |
|
| Q |
218 |
gttgcagcatgcataaaagcatc |
240 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
14008750 |
gttgcagcatgcataaaaccatc |
14008728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University