View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_high_13 (Length: 439)
Name: NF11781_high_13
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 36 - 431
Target Start/End: Complemental strand, 16764074 - 16763680
Alignment:
| Q |
36 |
tttaatatttctcccagtaatgggtatgatctctcctcactcccacaattcccacattatagtaatcctcaacacctgcttctttcgtcataaattctag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16764074 |
tttaatatttctcccagtaatgggtatgatctctcctcactcccacaattcccacattatagtaatcctcaacacctgcttctttcgtcataaattctag |
16763975 |
T |
 |
| Q |
136 |
atcaaattcaaccctttgaaaatcaacatannnnnnnnnnnacttcttatggggtatgtatgattgtgaccctttaatctaaaactctcttgtaaggctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16763974 |
atcaaattcaaccctttgaaaatcaacatatttttttttt-acttcttatggggtatgtatgattgtgaccctttaatctaaaactctcttgtaaggctc |
16763876 |
T |
 |
| Q |
236 |
cacacataccaacctacccaaaagttctttccctataaggctgttcttatggcaggtggcaagctttttggtggttctaatatgtcacttttgcttcaaa |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16763875 |
cacacataccaacctacccaaaagttctttccctataaggctgttcttatggcaggtggcaagctttttggtggttctaatatgtcacttttgcttcaaa |
16763776 |
T |
 |
| Q |
336 |
atgaaagactcccttgtacttctgaagtccttgaatctctttgggttcacacccctgcttcttttcaaggtgatctttacctcctcaattcttctc |
431 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16763775 |
atgaaagactcccttgtacttctgaagtccttgaatctctttgggttcacacccctgcttcttttcaaggtgatctttacctcctcaattcttctc |
16763680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University