View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_high_37 (Length: 241)
Name: NF11781_high_37
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_high_37 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 17857384 - 17857606
Alignment:
| Q |
19 |
ggtcctgctcgctatttttctaacctgctctgcatttccaagcatgccaacttttgtttctcacccttcttgatgttagcgacttagctttgcttcgctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17857384 |
ggtcctgctcgctatttttctaacctgctctgcatttccaagcatgccaacttttgtttctcacccttctggatgttagcgacttagctttgcttcgctt |
17857483 |
T |
|
| Q |
119 |
tctctcgtagtcaagtgaacaagatatgttaagccctgttgtgaataggatctgacccttttcgcactcttcttttgcttgattgatttggatcaaacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17857484 |
tctctcgtagtcaagtgaacaagatatgttaagccctgttgtgaataggatctgacccttttcgcactcttcttttgcttgattgatttggatcaaacct |
17857583 |
T |
|
| Q |
219 |
gttgttgacattagccgaactct |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17857584 |
gttgttgacattagccgaactct |
17857606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University