View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_high_41 (Length: 232)
Name: NF11781_high_41
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 30965308 - 30965506
Alignment:
| Q |
16 |
aagaaccttggacttactactggtcatgattcagtggtctatctaatagaaaagattaaatatggttcttatgtggtttttgtcatcattattatccata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| | | |
|
|
| T |
30965308 |
aagaaccttggacttactactggtcatgattcagtgctctatctaatagaaaagattaaatatggtttttatgtagtttttgtcatcattattatcaaaa |
30965407 |
T |
 |
| Q |
116 |
tcattgtggagataattcaaacattttataatgttcatagaatgtatcaattttactttggagagggccgtgagcagcgcttgaggatgaaggagaaaa |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965408 |
ccattgtggggataattcaaacattttataatgttcatagaatgtatcaattttactttggagagggccgtgagcagcgcttgaggatgaaggagaaaa |
30965506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University