View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_28 (Length: 297)
Name: NF11781_low_28
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 38831926 - 38831736
Alignment:
| Q |
1 |
tggtggtacgcatcaccaatcgatttagcagcagcaaatggccactacgatctcgtcattgagcttcttcacctcgacacaaacctcctcatcaaactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831926 |
tggtggtacgcatcaccaatcgatttagcagcagcaaatggccactacgatctcgtcattgagcttcttcacctcgacacaaacctcctcatcaaactca |
38831827 |
T |
 |
| Q |
101 |
cttcccttcaaagacttcgccgtctcgaatctctctggaaccacaacgaatctcagttccaaaccgtcgctaaatgtcgctctcacgtcgc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831826 |
cttcccttcaaagacttcgccgtctcgaatctctctggaaccacaacgaatctcagttccaaaccgtcgctaaatgtcgctctcacgtcgc |
38831736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 244 - 281
Target Start/End: Complemental strand, 38831683 - 38831646
Alignment:
| Q |
244 |
tctttggttaaagctggatatggtggatggcttcttta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38831683 |
tctttggttaaagctggatatggtggatggcttcttta |
38831646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University