View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_32 (Length: 251)
Name: NF11781_low_32
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 2045170 - 2045408
Alignment:
| Q |
11 |
cataggtggttggtgcataatgtttgtgaatannnnnnnnn--aaggaatgtttgtgagtattgtaaatctctatata---agtttgctcttaatcatag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2045170 |
cataggtggttggtgcataatgtttgtgaatattttttttgttaaggaatgtttgtgagtattgtaaatctctatgtatcaagtttgctcttaatcatag |
2045269 |
T |
|
| Q |
106 |
aaaaaacattgctt----gcgtgtaacattaaaatttaaattttattttatttaatcaagtgtaaaaatgagctaacaaagcaatgaatgttataagctc |
201 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2045270 |
aaaaaatattgcttacatgcgtgtaacattaaaattaaaattttattttatttaatcaagtgtaaaaatgagctaacaaatcaatgaatgttataagctc |
2045369 |
T |
|
| Q |
202 |
aaacttcgcttgatctaacatatcttaaaatgatataac |
240 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2045370 |
aaatttcgcttgatctaacatatctcaaaatgatataac |
2045408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University