View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_36 (Length: 242)
Name: NF11781_low_36
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 25 - 158
Target Start/End: Original strand, 9073118 - 9073251
Alignment:
| Q |
25 |
catctatctgtatgctcaaatgatgtttattttgctatcacgttaagacttctcaatattgtaattattgtttaaatatggattatgatgatggctcttc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9073118 |
catctatctgtatgctcaaatgatgtttattttgctatcacgttaagacttctcaatattgtaattattgtttaaatatggagtatgatgatggctcttc |
9073217 |
T |
|
| Q |
125 |
tttgattatttatgaacaatgtcatgtgaaactc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9073218 |
tttgattatttatgaacaatgtcatgtgaaactc |
9073251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 147
Target Start/End: Complemental strand, 4085576 - 4085537
Alignment:
| Q |
108 |
tatgatgatggctcttctttgattatttatgaacaatgtc |
147 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
4085576 |
tatgatggtgactcttctttgattatttatgaacaatgtc |
4085537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University