View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_37 (Length: 242)
Name: NF11781_low_37
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 7962711 - 7962930
Alignment:
| Q |
7 |
tcgtaaacacacacctaacccacaaatattagactgacagcaagacaaagacaggtagcttagcttaatctttgtaacactaactaacaaaagtgttaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962711 |
tcgtaaacacacacctaacccacaaatattagactgacagcaagacaaagacaggtagcttagcttaatctttgtaacactaactaacaaaagtgttaac |
7962810 |
T |
 |
| Q |
107 |
ttcttttctgtctttgtgttctgtttatgagttattgggtggaaagtgttacaaaacatggagcaacttaagctaacactttcacttttcttctccttct |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962811 |
ttcttttctgtctttgtgttctgtttttgagttattgggtggaaactgttacaaaacatggagcaacttaagctaacactttcacttttcttctccttct |
7962910 |
T |
 |
| Q |
207 |
ccgattcatcttcatggttt |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7962911 |
ccgattcatcttcatggttt |
7962930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University