View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_38 (Length: 241)
Name: NF11781_low_38
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 230
Target Start/End: Complemental strand, 33295567 - 33295355
Alignment:
| Q |
18 |
ataggttacagcaagattctaatcctaaacaaattcacatcaaaatggtccccagccaagccacatctacttgttttgatttgttatttgactaagatct |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33295567 |
ataggttacaacaagattctaatcctaaacaaattcacatcaaaatggtccccagccaagccacatctacttgttttgatttgttatttgactaagatct |
33295468 |
T |
 |
| Q |
118 |
ttgcagactagttatgcactaaaataatgtgacattctctctggctgagcttcaaacaaacgttgtctccaaggtagctaactaaatatgatgaatccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33295467 |
ttgcagactagttatgcactaaaataatgtgacattctctctggctgagcttcaaacaaacgttgtctccaaggtagctaactaaatatgatgagaccaa |
33295368 |
T |
 |
| Q |
218 |
attttactgtagg |
230 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
33295367 |
agtttactgtagg |
33295355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University