View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_41 (Length: 239)
Name: NF11781_low_41
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 272972 - 273191
Alignment:
| Q |
1 |
ttttgcgagaagctcaagtagttgcatcttcttcctacgaatcaaacacaaaatggggcacagaagtaagtagtggattcatacatttatcaaaatctag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
272972 |
ttttgcgagaagctcaagtagttgcatcttcttcctacgaatcaaacacaaaatggggcacagaagtaagt---gtattgatacatttatcaaaatctag |
273068 |
T |
 |
| Q |
101 |
ggagataccaagtaaatagatattttagtccttaaaattgtaaagatcgacaatataattctttgtattactaaatgtaaatttgaatttttattgacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
273069 |
ggagataccaagtaaatagatattttagtccttaaaattgtaaagatcgacaatataattctttatattactaaatgtaaatttgaatttttattgacag |
273168 |
T |
 |
| Q |
201 |
ataggattctcatatggcatctt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
273169 |
ataggattctcatatggcatctt |
273191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University