View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11781_low_44 (Length: 218)
Name: NF11781_low_44
Description: NF11781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11781_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 89 - 209
Target Start/End: Original strand, 4194990 - 4195110
Alignment:
| Q |
89 |
tagtagggcctagtttacctgattgacctgtccccacctaatgtgtcacaaaatcattacttcctacttacttccctccctacaaaaacaactcaaagca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4194990 |
tagtagggcctagtttacctgattgacctgtccccacctaatgtgtcacaaaatcattacttcctacttacttccctccctacaaaaacaactcaaagca |
4195089 |
T |
|
| Q |
189 |
ccacacacattctcacactct |
209 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4195090 |
tcacacacattctcacactct |
4195110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University