View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11782_low_6 (Length: 311)
Name: NF11782_low_6
Description: NF11782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11782_low_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 44 - 311
Target Start/End: Original strand, 38320126 - 38320392
Alignment:
| Q |
44 |
agctgcgtatactaatacttcgaatcgagaaaaactgtaatggataactatattcgaaccaacaacctcttgtccaaatgggaagagatattttatttta |
143 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
38320126 |
agctgcgtatactaataattcgaatcgagaaaaactgtaatggataactatattcgaaccaacaacctcttgtccaaatacgaagtgatattttatttta |
38320225 |
T |
 |
| Q |
144 |
ctacataatttattgctctttggttttctacagggggttgattttatgacctgatgatgtaaatttttctagactagtaaaatgccaattgtttatgctc |
243 |
Q |
| |
|
|| || ||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38320226 |
ttatatcatttattgctctttggttttctatagggg-ttgattttatgacctaatgatgtaaatttttctagactagtaaaatgccaattgtttatgctc |
38320324 |
T |
 |
| Q |
244 |
actatctagaagataattatggcctggtttaaaagtctttgtctccattccattggtacatggccagc |
311 |
Q |
| |
|
|||||| |||||| |||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38320325 |
actatcaagaagagaattatggtctggtttaaaagtctttgtctccattccattgatacatggccagc |
38320392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University