View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11782_low_7 (Length: 308)
Name: NF11782_low_7
Description: NF11782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11782_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 300
Target Start/End: Original strand, 30875107 - 30875391
Alignment:
| Q |
16 |
acatcacatcagttatattagggaacactggcataggaaataatgagcaaaagggaggaaaactctacatgtaatgttcataatttcatcagcagacaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30875107 |
acatcacatcagttatattagggaacactggcataggaaataatgagcaaaagggaggaaaactctacatgtaatgttcataatatcatcagcagacaat |
30875206 |
T |
|
| Q |
116 |
ttcattttttatgccagattggcgatttagaataatgatagaaaaatgcnnnnnnnttatcaaatggacatgcaatctctaccggcataccggtcttttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30875207 |
ttcattttttatgccagattggcgatttagaataataatagaaaaatgcaaaaaaaaaaacaaatggacatgcaatctctaccggcataccggtcttttc |
30875306 |
T |
|
| Q |
216 |
aatttaatctaaccaccttgtcctcgttattcttctccaaacgaggcacatcccttgtacttaattgaagggtacagtcatcatt |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30875307 |
aatttaatctaaccaccttgtcctcattattcttttccaaacgaggcacatcccttgtacttaattgaagggtacagtcatcatt |
30875391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University