View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11783_low_3 (Length: 276)
Name: NF11783_low_3
Description: NF11783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11783_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 161 - 261
Target Start/End: Original strand, 48415684 - 48415784
Alignment:
| Q |
161 |
gatactctggcattggatccttcgcattcgatgtaacgatttacaataatgtcacccaaagaatgtgtttgttgttgttgtgatggttgaaatttatgct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48415684 |
gatactctggcattggatccttcgcattcaatgtaacgatttacaataatgtcacccaaagaatgtgtttgttgttgttgtgatggttgaaatttatgct |
48415783 |
T |
 |
| Q |
261 |
g |
261 |
Q |
| |
|
| |
|
|
| T |
48415784 |
g |
48415784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 6 - 87
Target Start/End: Original strand, 48415523 - 48415604
Alignment:
| Q |
6 |
acatgtcatataatgtggctcagaagagtttatatgatggtgttagttttataaagaacggtctatataactatatgttgag |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48415523 |
acatgtcatataatgtggctcagaagagtttatatgatggtgttagttttataaagaacggtctatataactatatgttgag |
48415604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University