View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_high_21 (Length: 349)
Name: NF11784_high_21
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 162 - 333
Target Start/End: Original strand, 37062998 - 37063167
Alignment:
| Q |
162 |
tggggactaaccataaataacattgctataatggaatgagtnnnnnnnnnnnngtatattccgttgtttcttaacaaaactagagtgatgtgaagaggtt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062998 |
tggggactaaccataaataacattgctataatggaatgagtcacacacaca--gtatattccgttgtttcttaacaaaactagagtgatgtgaagaggtt |
37063095 |
T |
 |
| Q |
262 |
ttttgaacatagcgtaaaactagtttttctatgaccagcaattaatcaatcaatggggtgatggtgtatatg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
37063096 |
ttttgaacatagcgtaaaactagtttttctatgaccagcaattaatcaatcaacggggtgattgtgtatatg |
37063167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 69 - 137
Target Start/End: Original strand, 37062910 - 37062978
Alignment:
| Q |
69 |
aaaagacatatttttggtctattaggagcactcatttataatggaaacctcaataaaacctcgaacatg |
137 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062910 |
aaaagacatatgtttggtctattaggatcactcatttataatggaaacctcaataaaacctcgaacatg |
37062978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 37062827 - 37062877
Alignment:
| Q |
22 |
atgttatggtctatacttcattttcatcatttacttttgtttgcctaaaaa |
72 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
37062827 |
atgttatggtctatacttccttttcatcatttacttttgtttgcgtaaaaa |
37062877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University