View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_high_25 (Length: 306)
Name: NF11784_high_25
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 9366406 - 9366114
Alignment:
| Q |
1 |
aacaaagacatgtattaattttttgtgaaaattgtaaatatgaaaatcgtattaattttgtgtgaaaatcgtgatannnnnnnaagagaggttatgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
9366406 |
aacaaagacatgtattaattttttgtgaaaattgtaaatatgaaaatcgtattaattttgtgtgaaaatcgtgatatttttttaagaggggttatatttt |
9366307 |
T |
 |
| Q |
101 |
gatacatgtgaagaaagaattatacaatatttaagattattggtatgaaagaattcgggtgttctaagaagtggactgggcagacaatggatttggctgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9366306 |
gatacatgtgaagaaagaattatacaatatttaagattattggtatgaaagaattcgggtgt---aagaagtggactgggcagacaatggatttggctgg |
9366210 |
T |
 |
| Q |
201 |
ttctgtcataggggtccatttaatttgttctaattacattggcatgaagctaataagaatatggagcttttattatgatttcatacaaagcctttg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9366209 |
ttctgtcataggggtccatttaatttgttctaattacattggcatgaagctaataagaatatggagcttttattatgatttcatacaaagcctttg |
9366114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 84 - 142
Target Start/End: Complemental strand, 9370576 - 9370518
Alignment:
| Q |
84 |
aagagaggttatgttttgatacatgtgaagaaagaattatacaatatttaagattattg |
142 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
9370576 |
aagagaggttcagttttgatgcatctgaagatagaattatacaacatttaagattattg |
9370518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 9370516 - 9370484
Alignment:
| Q |
181 |
cagacaatggatttggctggttctgtcataggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
9370516 |
cagacaatggatttggctggttctgtcacaggg |
9370484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University