View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_high_28 (Length: 267)
Name: NF11784_high_28
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 28829789 - 28829563
Alignment:
| Q |
19 |
gagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtggcagagacaccggaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829789 |
gagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtggcagagacaccggaga |
28829690 |
T |
|
| Q |
119 |
aaagtgctgctacaccttcttgctggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgccggtgaccgatgaaccga |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28829689 |
aaagtgctgctacaccttcttgttggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgctggtgaccgatgaaccga |
28829590 |
T |
|
| Q |
219 |
accgggttggaaagctaatgctggtcg |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28829589 |
accgggttggaaagctaatgctggtcg |
28829563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University