View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11784_high_29 (Length: 248)

Name: NF11784_high_29
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11784_high_29
NF11784_high_29
[»] chr8 (2 HSPs)
chr8 (14-173)||(28759234-28759393)
chr8 (197-230)||(28759180-28759213)
[»] chr5 (2 HSPs)
chr5 (28-166)||(13756613-13756748)
chr5 (101-152)||(27969538-27969589)
[»] chr3 (1 HSPs)
chr3 (108-152)||(46047065-46047109)


Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 173
Target Start/End: Complemental strand, 28759393 - 28759234
Alignment:
14 agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaat 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
28759393 agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgttccatctgatggtggtgattggtgttttctgtctggttctgaat 28759294  T
114 ctgatgattctgattggtctattgggtggttggagcctcttggttctgattttgaaagca 173  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||    
28759293 ctgatgactctgattggtctattgggtggctggagcctcttggttctgattttgaaagca 28759234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 230
Target Start/End: Complemental strand, 28759213 - 28759180
Alignment:
197 gattctggtggtgatagttttgctgttttggttc 230  Q
    ||||||||||||||||||||||||||||||||||    
28759213 gattctggtggtgatagttttgctgttttggttc 28759180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 13756748 - 13756613
Alignment:
28 ggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgat 127  Q
    ||||||||| | | |||||||||||||||||||||| || ||  ||||||||||||||| | | |||||    || || |||||||||||||| || |||    
13756748 ggaagagaggagagttgatagagagtatgatgttgttttagtatcatctgatggtggtggtggttgttta---tcaggctctgaatctgatgactcagat 13756652  T
128 tggtctattgggtggttggagcctcttggttctgatttt 166  Q
    ||||||||||||||||| ||||||| |||||||||||||    
13756651 tggtctattgggtggttagagcctcatggttctgatttt 13756613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 27969538 - 27969589
Alignment:
101 tctggttctgaatctgatgattctgattggtctattgggtggttggagcctc 152  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||| ||||    
27969538 tctggttctgaatctgatgattctgattggtcaattggatggttggaacctc 27969589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 46047109 - 46047065
Alignment:
108 ctgaatctgatgattctgattggtctattgggtggttggagcctc 152  Q
    ||||||||| || |||||||||||||||||| |||||||||||||    
46047109 ctgaatctgttgcttctgattggtctattggctggttggagcctc 46047065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University