View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_high_30 (Length: 248)
Name: NF11784_high_30
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 37062604 - 37062366
Alignment:
| Q |
1 |
tttagccgaaagcgacgatggacgcttctcaagctggcttgccagaaacgcggtttcagtgtctccaccgcgaatattctgaacggaaacggagtcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062604 |
tttagccgaaagcgacgatggacgcttctcaagctggcttgccagaaacgccgtttcagtgtctccaccgcgaatattctgaacggaaacggagtcatca |
37062505 |
T |
|
| Q |
101 |
cgtacgttcaatgttatctccaccatttcaccatcgtccttgaagcttgcacttttgttcttgcttcggtttcgttgttttttggatgctaaaggcccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062504 |
cgtacgttcaatgttatctccaccatttcaccatcgtccttgaagcttgcacttttgttcttgcttcggtttcgttgttttttggatgctaaaggcccac |
37062405 |
T |
|
| Q |
201 |
tgaggcccacccctgagcttcggcttccggtgctctctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062404 |
tgaggcccacccctgagcttcggcttccggtgctctctg |
37062366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University