View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_high_31 (Length: 242)
Name: NF11784_high_31
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 62489 - 62289
Alignment:
| Q |
1 |
tattagagtaaatgtcacttttctagcttaatagaagatgaattaggatttgttgatgcagcgaaataacacagtttcgcagggttttcaataatagcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62489 |
tattagagtaaatgtcacttttctagcttaatagaagatgaattaggatttgttgatgcagcgaaataacacagtttcgcagggttttcaataatagcca |
62390 |
T |
|
| Q |
101 |
ttaaatttttccccnnnnnnntaaaataatagccattaaattttatcggatgctactattacacttttgtcaaactcatccaatggttgggataacaact |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
62389 |
ttaaatttttccccaaaaaaataaaataatagccattaaattttatcggatgctactattacacttttgtcaaactcatccaatggttgggataacaact |
62290 |
T |
|
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
62289 |
g |
62289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 8439334 - 8439398
Alignment:
| Q |
157 |
tattacacttttgtcaaactcatccaatggttgggataacaactgtgttgttttttacagcactg |
221 |
Q |
| |
|
||||| |||||||| |||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8439334 |
tattatacttttgttaaaccaatccaatgattggaataacaactgtgttgttttttacagcactg |
8439398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 224
Target Start/End: Complemental strand, 61453 - 61422
Alignment:
| Q |
193 |
taacaactgtgttgttttttacagcactgaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
61453 |
taacaactgtgttgttttttacagcactgaat |
61422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 224
Target Start/End: Complemental strand, 18096 - 18064
Alignment:
| Q |
192 |
ataacaactgtgttgttttttacagcactgaat |
224 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
18096 |
ataacaattgtgttgttttttacagcactgaat |
18064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University