View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11784_high_37 (Length: 205)

Name: NF11784_high_37
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11784_high_37
NF11784_high_37
[»] chr5 (2 HSPs)
chr5 (27-95)||(5435015-5435083)
chr5 (27-95)||(5448835-5448903)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 5435015 - 5435083
Alignment:
27 cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5435015 cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg 5435083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 5448835 - 5448903
Alignment:
27 cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5448835 cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg 5448903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University