View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11784_low_29 (Length: 267)

Name: NF11784_low_29
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11784_low_29
NF11784_low_29
[»] chr8 (1 HSPs)
chr8 (19-245)||(28829563-28829789)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 28829789 - 28829563
Alignment:
19 gagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtggcagagacaccggaga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28829789 gagataggatcagaccattttttcttcatcatatcatagagtcccatacgagtggtggaatagagacactgccggagaacggtggcagagacaccggaga 28829690  T
119 aaagtgctgctacaccttcttgctggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgccggtgaccgatgaaccga 218  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
28829689 aaagtgctgctacaccttcttgttggactagcttaacaccaacggcgatcggcccaacacggggcggttgggccgtcaccgctggtgaccgatgaaccga 28829590  T
219 accgggttggaaagctaatgctggtcg 245  Q
    |||||||||||||||||||||||||||    
28829589 accgggttggaaagctaatgctggtcg 28829563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University