View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_low_30 (Length: 252)
Name: NF11784_low_30
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 112 - 236
Target Start/End: Complemental strand, 11685949 - 11685831
Alignment:
| Q |
112 |
gaagacttgctgtgaatgtggaaaagagcttaagtcatgccccatctgcagaagctgcattaacactagaattaagctttactaaggttattgttgttct |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11685949 |
gaagacttgttgtgaatgtggaaaagagcttaagtcatgccccatctgcagaagctgcattaacactagaattaagctttactaaggttattgt------ |
11685856 |
T |
|
| Q |
212 |
tgttgttgaccattcatgtacatgt |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
11685855 |
tgttgttgaccattcatgtacatgt |
11685831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 91
Target Start/End: Complemental strand, 11686015 - 11685971
Alignment:
| Q |
47 |
aaattgttcaaaatacatcaaatatatgaggtatgttatttgata |
91 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11686015 |
aaattgctcaaaatacatcaaatatatgaggtatgttatttgata |
11685971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University