View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_low_31 (Length: 248)
Name: NF11784_low_31
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 173
Target Start/End: Complemental strand, 28759393 - 28759234
Alignment:
| Q |
14 |
agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28759393 |
agagaggagaaaaaggaagagagaacaattgatagagagtatgatgttgtgtttgttccatctgatggtggtgattggtgttttctgtctggttctgaat |
28759294 |
T |
 |
| Q |
114 |
ctgatgattctgattggtctattgggtggttggagcctcttggttctgattttgaaagca |
173 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28759293 |
ctgatgactctgattggtctattgggtggctggagcctcttggttctgattttgaaagca |
28759234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 230
Target Start/End: Complemental strand, 28759213 - 28759180
Alignment:
| Q |
197 |
gattctggtggtgatagttttgctgttttggttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28759213 |
gattctggtggtgatagttttgctgttttggttc |
28759180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 13756748 - 13756613
Alignment:
| Q |
28 |
ggaagagagaacaattgatagagagtatgatgttgtgtttgtgccatctgatggtggtgattggtgttttctgtctggttctgaatctgatgattctgat |
127 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||| || || ||||||||||||||| | | ||||| || || |||||||||||||| || ||| |
|
|
| T |
13756748 |
ggaagagaggagagttgatagagagtatgatgttgttttagtatcatctgatggtggtggtggttgttta---tcaggctctgaatctgatgactcagat |
13756652 |
T |
 |
| Q |
128 |
tggtctattgggtggttggagcctcttggttctgatttt |
166 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13756651 |
tggtctattgggtggttagagcctcatggttctgatttt |
13756613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 152
Target Start/End: Original strand, 27969538 - 27969589
Alignment:
| Q |
101 |
tctggttctgaatctgatgattctgattggtctattgggtggttggagcctc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
27969538 |
tctggttctgaatctgatgattctgattggtcaattggatggttggaacctc |
27969589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 46047109 - 46047065
Alignment:
| Q |
108 |
ctgaatctgatgattctgattggtctattgggtggttggagcctc |
152 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||| |
|
|
| T |
46047109 |
ctgaatctgttgcttctgattggtctattggctggttggagcctc |
46047065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University