View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11784_low_39 (Length: 205)
Name: NF11784_low_39
Description: NF11784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11784_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 5435015 - 5435083
Alignment:
| Q |
27 |
cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5435015 |
cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg |
5435083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 95
Target Start/End: Original strand, 5448835 - 5448903
Alignment:
| Q |
27 |
cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5448835 |
cggcttgattcgtactctgtatggatcggttctgttgttgttgtgtccttgcggttggatctgttgttg |
5448903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University