View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11785_high_14 (Length: 204)
Name: NF11785_high_14
Description: NF11785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11785_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 43728697 - 43728875
Alignment:
| Q |
9 |
aagcaaagggtaatttggttagatgaatcaattagcaattatggatgactattggtgacttgcaagcaaatattcaatgatttacttttgtctagatcat |
108 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43728697 |
aagcaaggggtaatttggttagatgaaacaattagcaattatggatgactattggtgacttgcaagcaaatatacaatgatttacttttgtctagatcat |
43728796 |
T |
 |
| Q |
109 |
ggcaatcgtttcaaaacagaatagctagaagaccgtggaatttgaagctacgttagtctctctttatacaagttcatga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43728797 |
agcaatcgtttcaaaacagaatagctagaagaccgtggaatttgaagctacgttagtctctctttatacaagttcatga |
43728875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University