View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11785_low_7 (Length: 375)

Name: NF11785_low_7
Description: NF11785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11785_low_7
NF11785_low_7
[»] chr8 (1 HSPs)
chr8 (187-228)||(4322509-4322551)
[»] chr2 (1 HSPs)
chr2 (190-228)||(5558755-5558793)
[»] chr6 (1 HSPs)
chr6 (190-248)||(24608308-24608368)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 228
Target Start/End: Complemental strand, 4322551 - 4322509
Alignment:
187 caaggccggccatgagggg-tgcaaacagctctattgagctgg 228  Q
    ||||||||||||||||||| |||||||||||||||||||||||    
4322551 caaggccggccatgagggggtgcaaacagctctattgagctgg 4322509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 228
Target Start/End: Complemental strand, 5558793 - 5558755
Alignment:
190 ggccggccatgaggggtgcaaacagctctattgagctgg 228  Q
    |||||| ||||||||||||||||||||||||||||||||    
5558793 ggccgggcatgaggggtgcaaacagctctattgagctgg 5558755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 248
Target Start/End: Complemental strand, 24608368 - 24608308
Alignment:
190 ggccggccatgagggg--tgcaaacagctctattgagctggacatcaaaaattttgaggcc 248  Q
    ||||||||||||||||  |||||||||||||| |||||||| | || ||||||||| ||||    
24608368 ggccggccatgaggggggtgcaaacagctctactgagctgggcctccaaaattttggggcc 24608308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University