View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_31 (Length: 443)
Name: NF11787_high_31
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 4e-76; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 3 - 179
Target Start/End: Complemental strand, 42635900 - 42635724
Alignment:
| Q |
3 |
gagaccgcatataataataatttaagaaaaataaaagtgattttatacaatacgtgtcagtgttggatcctgacttgtgtcaggctccagatgcatcttc |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
42635900 |
gagaccgcacataataataatttaagaaaaataaaagtgattttatacaatatgtgtcagtgttggatactgacttgtgtcaggctccagacgcatcttc |
42635801 |
T |
|
| Q |
103 |
aatatgaagtactccagacgcattttcaatatgaagtgtctatgctacataatctttaggaggtggtaagtgagctt |
179 |
Q |
| |
|
|||||||||| ||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42635800 |
aatatgaagtgctctagacgcatcttcagtatgaagtgtctatgctacataatctttaggaggtggtaagtgagctt |
42635724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 428
Target Start/End: Complemental strand, 42635569 - 42635517
Alignment:
| Q |
376 |
gacgtgatgcacatttttgaacgttcatttatcatatttacctcctaatttgt |
428 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42635569 |
gacgtgatgcacatttttgaacgttcatttatcatatttacctcctaatttgt |
42635517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 245 - 283
Target Start/End: Complemental strand, 42635724 - 42635686
Alignment:
| Q |
245 |
tatggaggtatgtatacttatgaacagctattgtttcaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42635724 |
tatggaggtatgtatacttatgaacagctattgtttcaa |
42635686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 213 - 291
Target Start/End: Original strand, 7228593 - 7228671
Alignment:
| Q |
213 |
cacttgtccaatcttttgtctcagcacccaaatatggaggtatgtatacttatgaacagctattgtttcaatcttttca |
291 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||| | || |||||||||||| ||||||| |
|
|
| T |
7228593 |
cacttgtccaaccttttgtctcagcacccaaatatgaaggtatgtatacttatcagcatctattgtttcaaccttttca |
7228671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 93
Target Start/End: Original strand, 7228342 - 7228417
Alignment:
| Q |
16 |
ataataatttaagaaaaataaaagtgattttatacaatacgtgtcagtgttggatcctgac-ttgtgtcaggctccaga |
93 |
Q |
| |
|
||||||||||||||||| | |||||||||| | |||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
7228342 |
ataataatttaagaaaa-tgaaagtgatttagtgcaat--gtgtcagtgttggatactgactttgtgtcaggctccaga |
7228417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 213 - 263
Target Start/End: Complemental strand, 49599139 - 49599089
Alignment:
| Q |
213 |
cacttgtccaatcttttgtctcagcacccaaatatggaggtatgtatactt |
263 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49599139 |
cacttgtccaaccttttgtctcagcacccaaatatgaaggtatgtatactt |
49599089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University