View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_49 (Length: 381)
Name: NF11787_high_49
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 8 - 359
Target Start/End: Complemental strand, 3085511 - 3085159
Alignment:
| Q |
8 |
aagcaaaggaaaatccgtaaaggcgtgtggctaatttggcatgctgcactttgcgtgatttggagggaaagaaacaaaagaattcatcacaatagggtgc |
107 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3085511 |
aagcaaaggaaaatctgtaaaggtgtgtggctaatttggcatgccgcgctttgcgtgatttggagggaaagaaacaaaagaattcatcacaatagggtgc |
3085412 |
T |
|
| Q |
108 |
gaacgattgatgaaatagtggaagagataaaagttcgataatggcatattggagttaaagtagattgaaaatagatccctg--tctttttatgagtagac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3085411 |
gaacgattgatgaaatagtggaagagataaaagttcgataatggcatattggagttaaagtagattgaaaatagatccctgtctctttttatgagtagac |
3085312 |
T |
|
| Q |
206 |
ttggaacccaaaagattgtttaagaagatgaaaaggggtggcttttgtccattcttttcccgtggggttagtgttgggctgagacatcaagtgtacactc |
305 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3085311 |
ttggaacccaaaagattgtttaaggagatgaaaaggggtggtttttgtccattc-tttcccgtggggttagtgctgggctgagacatcaagtgtacactc |
3085213 |
T |
|
| Q |
306 |
ttgcgtggtagtttttggtgtagggctggctatggccatgcttatgtttgatct |
359 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
3085212 |
ttgcgtggtagtttttggtgtagggctgcctatggctattcttatgtttgatct |
3085159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University