View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_57 (Length: 357)
Name: NF11787_high_57
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 18 - 344
Target Start/End: Complemental strand, 49897462 - 49897136
Alignment:
| Q |
18 |
atgggttccctctaaagcttcaaaatttgtagatttcacctactgggtcaccatgttgaagcaatttctaagtaaacttcctcgcaaagcatcaaaacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49897462 |
atgggttccctctaaagcttcaaaatttgtagatttcacctactgggtcaccatgttgaagcaatttctaagtaaacttcctcgcaaagcatcaaaacat |
49897363 |
T |
 |
| Q |
118 |
gactcggacgagtcgtgcagagtcgattcgcacgattcgcatcgagtcaccggtaaaaacaaccgttcacaaggcggcaacgatgggggtaaagccaacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49897362 |
gactcggacgagtcgtgcagagtcgattcgcacgattcgcatcgagtcaccggtaaaaacaaccgttcacaaggcggcaacgatgggggtaaagccaacg |
49897263 |
T |
 |
| Q |
218 |
ccgcgaaaaggaattcatcagcagcggtttttccgacaagcaccgtgtcgttgattgaaccgttggtgccgtttaaggatgttcctagctcggagaaaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49897262 |
ccgcgaaaaggaattcatcagcagcggtttttccgacaagcaccgtgtcgttgattgaaccgttggtgccgtttaaggatgttcctagctcggagaaaat |
49897163 |
T |
 |
| Q |
318 |
gaacctctttgtaagcaagttgagtct |
344 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49897162 |
gaacctctttgtaagcaagttgagtct |
49897136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University