View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_60 (Length: 331)
Name: NF11787_high_60
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 35603274 - 35602971
Alignment:
| Q |
18 |
gtatggatcttctcaaggaaccctatatcatgcaaagtatcactcacatgagtatcatatgaaatttgatgatttcgcctcgggttcaaacatttctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603274 |
gtatggatcttctcaaggaaccctatatcatgcaaagtatcactcacatgagtatcatatgaaatttgatgatttcgcctcgggttcaaacatttctttg |
35603175 |
T |
 |
| Q |
118 |
gcgtttagcccaccaatgcttgcagactcgtgccaaactcatcacccacatatgccatgtgacgatatttgtgtatattgtgagaaacttctggaaaccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| || |||||||||| ||||||||| |
|
|
| T |
35603174 |
gcgtttagcccaccaatgcttgcagactcgtgccaaactcatcacccacatatgccatgtgacaatgtttgtgtatcttctgagaaacttgtggaaaccc |
35603075 |
T |
 |
| Q |
218 |
atatgcacactttctttctttgtcataaggctttgaattgttttgtaaaaatgggattgataatatcgttcggtagctacttctcagtgttaacattttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35603074 |
atatgcacactttctttctttgtcataaggctttgaattgttttgtaaaaatgggattgataatatcgttcggtagctacttctcagtgttaacattttc |
35602975 |
T |
 |
| Q |
318 |
tctg |
321 |
Q |
| |
|
|||| |
|
|
| T |
35602974 |
tctg |
35602971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University