View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_65 (Length: 293)
Name: NF11787_high_65
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 22 - 278
Target Start/End: Complemental strand, 49897044 - 49896788
Alignment:
| Q |
22 |
gtttcttctttggggtctaaaaagtttaggaagccagttattctggcaatggttagaatgtgtgctatcaatctctttgccttttccccgccacattata |
121 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||||| |||||| |||||| ||| ||||||||||||||||||||| | ||| |||||||||||||| |
|
|
| T |
49897044 |
gtttcttcttttgggtctgcaaagtttagtgagccagctattcttgcaatgtgtaggatgtgtgctatcaatctctttcgcgttttcccgccacattata |
49896945 |
T |
 |
| Q |
122 |
gggctcataatcgaattggtggcggtgagaatgatgatgatgaaccagcttttgatcctgcttggcctcatcttcaacttgtttacgaattgttgcttaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49896944 |
gggctcataatcgaattggtggcggtgagaatgatgatgatgaaccagcttttgatcctgcttggcctcatcttcaacttgtttacgaattgttgcttaa |
49896845 |
T |
 |
| Q |
222 |
atttataacatcttcttgtcttgatgctaaggtggctaaaaagtattttgatcattc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49896844 |
atttataacatcttcttgtcttgatgctaaggtggctaaaaagtattttgatcattc |
49896788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 140 - 280
Target Start/End: Original strand, 2030502 - 2030642
Alignment:
| Q |
140 |
gtggcggtgagaatgatgatgatgaaccagcttttgatcctgcttggcctcatcttcaacttgtttacgaattgttgcttaaatttataacatcttcttg |
239 |
Q |
| |
|
|||||||||||| |||||||||||| || ||||||||||||||||| ||| | ||||||||||| |||||| |||||||||||||| | || | || |
|
|
| T |
2030502 |
gtggcggtgagactgatgatgatgatcctatgtttgatcctgcttggccacatttacaacttgtttatgaattgctgcttaaatttatatcttcaacgtg |
2030601 |
T |
 |
| Q |
240 |
tcttgatgctaaggtggctaaaaagtattttgatcattcat |
280 |
Q |
| |
|
||||||||||||||| || ||||||||| | |||||||||| |
|
|
| T |
2030602 |
tcttgatgctaaggtagcgaaaaagtatatcgatcattcat |
2030642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University