View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_68 (Length: 278)
Name: NF11787_high_68
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_68 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 86 - 262
Target Start/End: Complemental strand, 28994968 - 28994785
Alignment:
| Q |
86 |
aggtagaattaatatattcgaatatgttgaggtcaaaatttaaatgtcagatttttcgtttattcactttaaagataaatacctaactattagttactat |
185 |
Q |
| |
|
||||||||| |||| ||| |||||||| ||||||||||||||||||||||||| ||| ||| ||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
28994968 |
aggtagaatcaatacattagaatatgtcgaggtcaaaatttaaatgtcagattcttccttt-ttcactttaaagataaatacccaactattagttgctat |
28994870 |
T |
|
| Q |
186 |
ttgac--------nnnnnnnnnccttatttacggaaggtgcaacaacaattagaatttgtttggcaaggcaaaaccactacttat |
262 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28994869 |
ttgaccaaaaaaaaaaaaaaaaccttatttacggaaggtgcaacaacaattagaatttgtttggcaaggcaaaaccactacttat |
28994785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 101
Target Start/End: Complemental strand, 28995561 - 28995498
Alignment:
| Q |
38 |
cttctataatgaacaaatttagttacgtcttcgtaaatttgactcaacaggtagaattaatata |
101 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||| ||||||||| ||||||||| |||||| |
|
|
| T |
28995561 |
cttctataataaacaaatttagttacgtcttcctaaacttgactcaataggtagaatcaatata |
28995498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University