View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_72 (Length: 258)
Name: NF11787_high_72
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 3592471 - 3592678
Alignment:
| Q |
1 |
tggtctcaactgatctaaatgttccttgggatgattctgatatcaaaccttnnnnnnn--cgaaccggacagttcaaccgacttttattgtggtttggtt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592471 |
tggtctcaactgatctaaatgttccttgggatgattctgatatcaaaccttaaaaaaaaacgaaccggacagttcaaccgacttttattgtggtttggtt |
3592570 |
T |
|
| Q |
99 |
attttggcagttcgatcacgggcggttcaagacggttgaatcatgatctagaagtctcacctgttcgatgtccagttcaggttttaaaccattgctttga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592571 |
attttggcagttcgatcacgggcggttcaacacggttgaatcatgatctagaagtctcacctgttcgatgtccagttcaggttttaaaccattgctttga |
3592670 |
T |
|
| Q |
199 |
tataaaaa |
206 |
Q |
| |
|
|||||||| |
|
|
| T |
3592671 |
tataaaaa |
3592678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University