View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_high_73 (Length: 256)
Name: NF11787_high_73
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_high_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 61 - 251
Target Start/End: Original strand, 6489202 - 6489392
Alignment:
| Q |
61 |
ggttcggtttcttcattgtcacagaagagagatgcaatctgctttaatggatccaaattcaattgagaataaccgttttgatggtgctgagttccgcatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489202 |
ggttcggtttcttcattgtcacagaagagagatgcaatctgctttaatggatccaaattcaattgagaataaccgttttgatggtgctgagttccgcatt |
6489301 |
T |
|
| Q |
161 |
cgtgactgcaaccgcaatttaatacagcattcattgacgacgttgttgctgctgccgtgatgtatctggtgtccgtgtctgattctgtgct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6489302 |
cgtgactgcaaccgcaatttaatacagcattgattgatgacgttgttgctgctgccgtgatgtatctggtgtccgtgtctgattccgtgct |
6489392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 6489142 - 6489181
Alignment:
| Q |
1 |
tctcttctttatttcatctctctatttcaaaatgtaactg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489142 |
tctcttctttatttcatctctctatttcaaaatgtaactg |
6489181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University