View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_71 (Length: 291)
Name: NF11787_low_71
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 279
Target Start/End: Original strand, 10770990 - 10771261
Alignment:
| Q |
18 |
gatattttatgtggttatctatattcgaacttgtgatccctatgtg--------tacgaacttgcaactgagcctacatacaaaaattgaacttttaact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10770990 |
gatattttatgtggttatctatattcgaacttgtgatccctatgtgtagttgtgtacgaacttgcaactaagcctacattcaaaaattgaacttttaact |
10771089 |
T |
 |
| Q |
110 |
tcatggaacaggggtacaacaatttaaagaacgtgtcttgtaatattcatccttttgtaagtcatgaacattgcattatacatgtagtgg-tcggggttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| | |||| ||||||||||| |||||||||| | ||||||| |
|
|
| T |
10771090 |
acatggaacaggggtacaacaatttaaagaa--tgtcttgtaatattcatcattttgtaactaatgatcattgcattatccatgtagtggttgggggttc |
10771187 |
T |
 |
| Q |
209 |
gaattcgaattctccacttatttatc---nnnnnnnnngaaggatccacttatttaccttaaaatgatggaaat |
279 |
Q |
| |
|
|||||| ||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10771188 |
gaattcaaattccccatttatttatctttttttttttttaaggatccacttatttaccttaaaatgatggaaat |
10771261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University