View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_72 (Length: 287)
Name: NF11787_low_72
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_72 |
 |  |
|
| [»] scaffold0232 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 42215980 - 42216233
Alignment:
| Q |
18 |
gaaatatatgagggatagtatgggattgggaaatgtaaacatgcctttatggctgtatataagaattttaaatttaatcgcttttggtttggtttggttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42215980 |
gaaatatatgagggatagtatgggattgggaaatgtaaacatgcctttatggatgtatataagaattttaaatttaatcgcttttggtttggtttggttt |
42216079 |
T |
 |
| Q |
118 |
ttaaaccatgcacatccctgcttaggatatgaattcaaagccacaatctctcacttgtgagcaatatgactttagttgatagagtttttcaaaaagaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216080 |
ttaaaccatgcacatccctgcttaggatatgaattcaaagccacaatctctcacttgtgagcaatatgactttagttgatagagtttttcaaaaagaaat |
42216179 |
T |
 |
| Q |
218 |
aaaagagaaataatttttctataaccaccaattgatatctttttacaacaattt |
271 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216180 |
aaaagagaaatgatttttctataaccaccaattgatatctttttacaacaattt |
42216233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 105 - 136
Target Start/End: Original strand, 35126978 - 35127009
Alignment:
| Q |
105 |
tttggtttggtttttaaaccatgcacatccct |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35126978 |
tttggtttggtttttaaaccatgcacatccct |
35127009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0232 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0232
Description:
Target: scaffold0232; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 21454 - 21418
Alignment:
| Q |
100 |
tttggtttggtttggtttttaaaccatgcacatccct |
136 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
21454 |
tttggtttggtttggtttatgaaccatgcacatccct |
21418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University