View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_80 (Length: 244)
Name: NF11787_low_80
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 31708523 - 31708277
Alignment:
| Q |
1 |
ttcttggtttaatatggaaaacatagtttgcttttgtttgaacttataaacagtaacactactttggaaaa------------acctttgaaacttcaac |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
31708523 |
ttcttggtttaatatggaaaacatagtttgcttttgtttaaatttataaacagtaacactactttggattagaggtttttttaacctttgaaacttcaac |
31708424 |
T |
 |
| Q |
89 |
aaaatcaaggtggcacattgatttttggcaaatttactgtaattctaaacatgaacttgaatatcataaaaatccatttgaaaaatgatatcaatttaag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31708423 |
aaaatcaaggtggcacattgatttttggcaaatttactgtaattctaaacatgaacttgaatatcataaaaatccatttgaaaaatgatatc-atttaac |
31708325 |
T |
 |
| Q |
189 |
tagnnnnnnnnnncaccaattaccatgaaaccaaacacaaattttgttc |
237 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31708324 |
tag-tttttttctcaccaatcaccatgaaaccaaacacaaattttgttc |
31708277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University