View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_82 (Length: 242)
Name: NF11787_low_82
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 41065383 - 41065168
Alignment:
| Q |
1 |
tacagaaggactcaacaaggcaattaactcaacaaccgttgtggcagtactaatagcaacggttgcatttgctgcgatttacactgtccctggtcaattt |
100 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41065383 |
tacagaaggactcaacaatgcaataaactcaacaaccgttgtggcagtactaatagcaacggttgcatttgctgcgattttcactgtccctggtcaattt |
41065284 |
T |
|
| Q |
101 |
gttgatgatccaaacaatattccggaagggatgatacttggtgaagcaaatatatctccagaagcaccgtttataattttctttgtatttgattctattg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41065283 |
gttgatgatccaaacaatattccagaagggatgatacttggtgaagcaaatatatctccagaagcaccgtttataattttctttgtatttgattctattg |
41065184 |
T |
|
| Q |
201 |
cactcttcatctctct |
216 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
41065183 |
cactcttcatttctct |
41065168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 2 - 114
Target Start/End: Complemental strand, 23031816 - 23031704
Alignment:
| Q |
2 |
acagaaggactcaacaaggcaattaactcaacaaccgttgtggcagtactaatagcaacggttgcatttgctgcgatttacactgtccctggtcaatttg |
101 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||| || || ||||| || |||||||||||||| || || || || | ||||||||| || ||||| | |
|
|
| T |
23031816 |
acagaaggactcaacaatgcaataaactccacaacagtcgtcgcagtcctcatagcaacggttgccttcgcagccatcttcactgtcccaggccaattcg |
23031717 |
T |
|
| Q |
102 |
ttgatgatccaaa |
114 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
23031716 |
tggatgatccaaa |
23031704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University