View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_83 (Length: 241)
Name: NF11787_low_83
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 51000111 - 51000334
Alignment:
| Q |
1 |
tgtcaaagatacttgaacatcagatattggtgagcttgttttggaagaggaaggcactgaactactatgagagctgctatcacccagggttaccggaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51000111 |
tgtcaaagatacttgaacatcagatattggtgagcttgttttggaagaggaaggcactgaaccactatgagagctgctaccacccagggttaccggaact |
51000210 |
T |
|
| Q |
101 |
acatgcaaatgtgagaatatgccagatttgcggccctgtaaagtgtgaagcattatataaaaccatttaaaatatgcaaaacaagcatatttgaagaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000211 |
acatgcaaatgtgagaatatgccagacttgcggccctgtaaagtgtgaagcattatataaaaccatttaaaatatgcaaaacaagcatatttgaagaacc |
51000310 |
T |
|
| Q |
201 |
acaatatgcttgggggatccatct |
224 |
Q |
| |
|
|||||||| ||||| ||||||||| |
|
|
| T |
51000311 |
acaatatggttgggagatccatct |
51000334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University