View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_90 (Length: 208)
Name: NF11787_low_90
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 29521797 - 29521969
Alignment:
| Q |
18 |
ctttgataattaaggcctttggggaaacaactttatgtgtgagccctcagcttaattgaatctaacttttttgctcaagtagataatgactttcaaaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29521797 |
ctttgataattaaggcctttggggaaacaactttatgtgtgagccctcagcttaattgaatctaacttttttgctcaagtagataatgactttcaaaata |
29521896 |
T |
 |
| Q |
118 |
tggtttaaaaggnnnnnnnnnnctctacattattacacatttaatcatcattctacataacatgattaagtct |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29521897 |
tggtttaaaaggaaaaaaaaaactctacattattacacatttaatcatcattttacataacatgattaagtct |
29521969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University