View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11787_low_91 (Length: 205)
Name: NF11787_low_91
Description: NF11787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11787_low_91 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 69 - 190
Target Start/End: Original strand, 19959313 - 19959434
Alignment:
| Q |
69 |
ttgaaaaactaagtttattttgatttgtgatggttgaaaatttcagataaagagggagatatcaactttgaagcttctgaaacatcctaatgttgttaga |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19959313 |
ttgaaaaactaagtttattttgatttgtgatggttgaaaatttcagataaagagggagatatcaaccttgaagcttctgaaacatcctaatgttgttaga |
19959412 |
T |
 |
| Q |
169 |
ttatacgaggtaacatcctatg |
190 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19959413 |
ttatacgaggtaacatcctatg |
19959434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 181
Target Start/End: Complemental strand, 51100398 - 51100322
Alignment:
| Q |
105 |
aaaatttcagataaagagggagatatcaactttgaagcttctgaaacatcctaatgttgttagattatacgaggtaa |
181 |
Q |
| |
|
|||||| |||||||||||||| |||| | |||||||| || | ||||| |||||||||| |||||||||||||| |
|
|
| T |
51100398 |
aaaattgcagataaagagggaaatatgtgccttgaagctcctaaggcatcccaatgttgttaaattatacgaggtaa |
51100322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University